• Users Online: 229
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2020  |  Volume : 11  |  Issue : 4  |  Page : 174-179

Semi-nested polymerase chain reaction over blood culture in detection of bloodstream fungal infection in leukemic children with febrile neutropenia


1 Department of Microbiology, Institute of Medical Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh, India
2 Department of Pediatrics, Institute of Medical Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh, India
3 Department of Pathology, Institute of Medical Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh, India

Date of Submission13-Apr-2020
Date of Decision25-May-2020
Date of Acceptance31-Jul-2020
Date of Web Publication17-Nov-2020

Correspondence Address:
Dr. Deepak Kumar
Department of Microbiology, Institute of Medical Sciences, Banaras Hindu University, Varanasi - 221 005, Uttar Pradesh
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/joah.joah_41_20

Rights and Permissions
  Abstract 

BACKGROUND: Children with hematologic malignancies are currently at a severe threat of developing bloodstream fungal infection (BSFI). The early detection of BSFI followed by appropriate management of these patients remains a challenge to the oncologist of today. The conventional method of detection like blood culture followed by identification is time-consuming and of low accuracy. The molecular approaches like polymerase chain reaction (PCR) and its variants like semi-nested PCR (SnPCR) can be an attractive alternative to diagnose early and accurately BSFI but need to be explored.
OBJECTIVE: The aim of our study was to determine the utility of SnPCR over conventional blood culture in detecting BSFI in leukemic children with febrile neutropenia.
MATERIALS AND METHODS: A total of 53 pediatric patients with febrile neutropenia due to hematological malignancy were included in this study. From each patient, blood sample was collected for conventional blood culture, while SnPCR was performed from the overnight incubated blood broth. The blood culture-positive isolates were further identified to species level using conventional techniques. The PCR products obtained were sequenced and results interpreted after nucleotide BLAST and refinement.
RESULTS: Fungal DNA was detected in 13 (24.5%) febrile neutropenic patients by SnPCR, while the conventional blood culture could detect only 6 (11.3%) fungemia cases. The SnPCR had a sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of 93%, 100%, 100%, 98%, and 98%, respectively, versus 43%, 100%, 100%, 83%, and 85%, respectively, for blood culture. The results by SnPCR alone showed almost perfect agreement with the results of the combined method (κ = 0.95) in the detection of BSFI.
CONCLUSION: The SnPCR method proved to be better compared to blood culture for the early and accurate detection of BSFI in febrile neutropenic pediatric patients.

Keywords: Blood culture, bloodstream fungal infection, hematologic malignancy, neutropenia, semi-nested polymerase chain reaction


How to cite this article:
Paul P, Pandey N, Gupta V, Tilak V, Kumar D, Tilak R. Semi-nested polymerase chain reaction over blood culture in detection of bloodstream fungal infection in leukemic children with febrile neutropenia. J Appl Hematol 2020;11:174-9

How to cite this URL:
Paul P, Pandey N, Gupta V, Tilak V, Kumar D, Tilak R. Semi-nested polymerase chain reaction over blood culture in detection of bloodstream fungal infection in leukemic children with febrile neutropenia. J Appl Hematol [serial online] 2020 [cited 2020 Nov 27];11:174-9. Available from: https://www.jahjournal.org/text.asp?2020/11/4/174/300766


  Introduction Top


Advances in the field of medicine have greatly improved the prognosis of children with leukemia. While progress has been made in eradicating malignant disease, a growing concern for patients who receive cytotoxic chemotherapy is the development of life-threatening bloodstream fungal infections (BSFIs).[1] Treatment with dose-intensive regimen that results in profound neutropenia and mucosal damage, is one of the most important contributing factor to increased frequency of BSFI leading to severe fungal infections. These dose-intensive regimens result in profound neutropenia and mucosal damage leading to severe fungal infections.[2] A vast majority of encountered fungal infections in this group of patients are caused by Candida albicans followed by Aspergillus fumigatus.[3] According to recent studies, the prevalence of infections caused by non-C. albicans (essentially Candida tropicalis, Candida parapsilosis, Candida glabrata, and Candida krusei) and other yeast genera is increasing.[4],[5] Furthermore, the infections with rare/emerging pathogens such as non-fumigatus aspergillus spp., hyaline molds (e.g., Fusarium spp.), and Malassezia are a growing challenge for the oncologist today.[6],[7]

An appropriate and early diagnosis of children with leukemia suspecting of fungal infection is a topic of keen interest among the researchers of today. The conventional methods of detection which rely on isolation of pathogen by blood culture followed by phenotypic identification are time-consuming and of low accuracy.[8] Thus, the recently introduced molecular approaches to diagnose the fungal infection are proving as an attractive alternative. Of various molecular approaches, amplification-based assays have been developed to offer improvements in the detection of fungi, not only in terms of timely diagnosis but also when results provided by conventional diagnostic methods are questionable. The polymerase chain reaction (PCR) with primers targeted to gene sequences unique to fungi has been used most widely by the researchers.[9] However, the detection of a fungal pathogen by PCR lacks sensitivity when a single-round amplification is performed using a direct blood sample. The introduction of nested PCR technology in the detection of fungal infections has increased the sensitivity of PCR results compared to results obtained by conventional PCR.[10] DNA amplification with species-specific identification of a fungus followed by sequencing of the internal transcribed spacer (ITS) region of the fungal rRNA operon is becoming important molecular targets for taxonomic classification and identification. The ITSl and ITS2 domains, due to greater sequence variation, are more suited for species and strain identification than the 18S region (small subunit), the 5.8S region, and the 28S region (large subunit).[11] With this background knowledge, we have designed semi-nested PCR (SnPCR) protocol using universal and species-specific primers for early and accurate detection of common pathogenic fungus from overnight incubated blood broth in febrile neutropenic leukemic children.


  Materials and Methods Top


Ethical consideration

The study plan was approved by the Institute Ethics Committee of Institute of Medical Sciences BHU Varanasi, and informed consent was obtained from each of the participants/guardians.

Study design

The present study is observational, carried out in the Department of Microbiology, Pathology and Pediatrics, Institute of Medical Sciences BHU Varanasi. The total duration of the study was 1 year and 10 months from July 2015 to April 2017.

In the study, a total of 53 pediatric patients with febrile neutropenia due to hematological malignancy admitted to the pediatric department were screened as per the inclusion criteria of our study.

The inclusion criteria were as follows: age ≤19 years, a previously confirmed case of leukemia, patients undergoing the induction phase of chemotherapy, and those having febrile neutropenia of >1-week duration. The febrile neutropenic patients on antifungal therapy were excluded from the study. The following patients' characteristics were taken into consideration: type and stage of hematologic malignancy, clinical signs, and treatment received.

Definitions

There is no strict definition of neutropenia, but this term is used to define an absolute neutrophil count (ANC) of ≤1500 cells down to an ANC of ≤500 cells/μL. Febrile neutropenia is defined as oral temperature >38.5°C or two consecutive readings of >38°C for 2 h and ANC: <0.5 × 109/L or expected to fall below 0.5 × 109/L.

Processing of the sample

Blood culture method

From each patient, 2-5 ml of the blood sample was obtained aseptically in BHI broth containing blood culture bottle and was incubated at 37°C. After overnight incubation, 1 ml of blood broth was drawn from each blood culture bottle using a sterile syringe for SnPCR study and was stored at − 20°C temperature until further use. After 48 h of incubation, the first blind subculture was done on two Sabouraud's dextrose agar (SDA) slopes and incubated at 25°C and 37°C for 7 days. The subculture tubes were examined daily for 1 week. Similarly, the second subculture was done after 7-day incubation of BHI broth and final subculture (for those samples which showed no growth after 7 days) after 28-day incubation. The culture results were accounted; colonies suggestive of fungal growth in SDA tube were further identified by phenotypic methods.[12]

Semi-nested polymerase chain reaction method

Extraction of DNA

DNA was extracted using 1 ml of blood broth obtained after overnight incubation of blood culture bottle using the QIAamp 96 DNA Blood Kit (Qiagen, Hilden, Germany). A volume of 200 μl of blood broth was used for extraction, and DNA was eluted in 100 μl of elution buffer. The entire procedure was performed according to the manufacturer's instructions.

Reagents

Taq polymerase enzymes and customized primers were procured from SBS Genetech Co., Ltd., China.

Polymerase chain reaction amplification of fungal ribosomal genes

SnPCR with the primers pairs ITS1 and ITS4 for the primary cycle and ITS1 and ITS2 for semi-nested cycle targeting all common pathogenic fungi was performed.[13]

(a)First-round amplification: The universal primers used for fungal amplification were ITS1 (5'TCC GTA GGT GAA CCT GCG G 3'), which hybridizes at the end of 18S rDNA, and ITS4 (5'TCC TCC GCT TAT TGA TAT GC 3'), which hybridizes at the beginning of 28S rDNA.

(b) Semi-nested amplification: For the second amplification, the primers used were ITS1 and ITS2 (5'GCTGCGTTCTTCATCGATGC 3'), which hybridize with the 5.8S rDNA region.

Amplification of DNA

The PCR reaction was carried out in 25 μl volume with the reaction mix contained × 10 reaction buffer (5 μl/sample), dNTPs (2 μl/sample), forward and reverse primers, and Taq polymerase enzyme (0.66 pmol). Amplification was carried out on Bio-Rad system with a heated lid. The hot start method was employed by heating at 94°C for 5 min initially. Thereafter, amplification was carried out for 35 cycles at 90°C for 1 min (denaturation), 65°C for 1 min (annealing), and 72°C for 1 min (extension). An extra extension was carried out at 72°C for 7 min. The amplification products of primary PCR were again amplified with nested primers following the same protocol. The final amplification product (200–300 bp) was separated on 1.2% agarose gel electrophoresis and visualized by ethidium bromide staining. The 100 bp DNA ladder was used as a DNA molecular weight standard. Gel electrophoresis with 1.2% agarose gels was conducted with 1 × TBE buffer (0.1 M Tris, 0.09 M boric acid, 1 mM EDTA). A. fumigatus clinical isolate as the positive control for molds, C. albicans ATCC 90028 as the positive control for yeast, and double-distilled water as negative control were run with each batch of samples analyzed. Documentation of gel was done by gel doc system Bio-Rad made in the USA. The sequence analysis of the precise lengths of the PCR products was outsourced.

Statistical analysis

Continuous variables such as age and ANC were summarized using descriptive summary statistics (mean and range). Categorical variables such as blood culture and SnPCR results were tabulated and presented as a percentage. Diagnostic validity test (diagnostic sensitivity and specificity, positive and negative predictive values [PPV and NPV], and test accuracy) was calculated. κ-test was done to measure the agreement between two methods (<0 = poor agreement, 0.0–0.20 = slight agreement, 0.21–0.40 = fair agreement, 0.41–0.60 = moderate agreement, 0.61–0.80 = substantial agreement, and 0.81–1.00 = almost perfect agreement).


  Results Top


The study population comprised 40 males and 13 females, with M:F ratio of 3.1:1, and the mean age of the patients was 8.2 years (standard deviation: 3.9), as shown in [Table 1]. The mean ANC of these patients was 364 cells/mm, and the most common hematological disorders were acute lymphoblastic leukemia (ALL) 41 (77.4%), followed by acute myeloid leukemia (AML) 12 (22.6%). Blood culture grew positive for fungus in 6 (11.3%) of the cases which were phenotypically identified as 4 Candida spp., 1 A. fumigatus, and 1 Penicillium marneffei [Table 2]. A positive fungal DNA was detected in 13 patients (24.53%) by SnPCR [Table 3]. Through sequence analysis, the nucleotide sequence of the PCR products amplified by the fungus-specific, universal primers ITS1 and ITS2 was determined. The results obtained after nucleotide Basic local alignment and search tool (BLAST) and refining/realigning were tabulated [Table 4] and compared with culture results. The SnPCR failed to detect fungal DNA in one blood culture-positive patient that was phenotypically identified as P. marneffei.
Table 1: Demographic, clinical, and laboratory data of 53 pediatric patients

Click here to view
Table 2: Blood culture results of 53 pediatric patients

Click here to view
Table 3: Sequencing followed by nucleotide blast refining/realigning result of 13 semi-nested polymerase chain reaction products

Click here to view
Table 4: Comparative results of 14 positive samples by semi-nested polymerase chain reaction and blood culture methods

Click here to view


For the sake of comparison, we have assumed the combined positivity by either of the method blood culture or SnPCR as a gold standard. The positivity rate of SnPCR, when compared with the gold standard, was found to have a sensitivity, specificity, PPV, NPV, and accuracy of 93%, 100%, 100%, 98%, and 98%, respectively. Similarly, the sensitivity, specificity, PPV, NPV, and accuracy were 43%, 100%, 100%, 83%, and 85%, respectively, when positivity of blood culture was compared with the above mentioned gold standard (combined positivity). Applying kappa statistics, the results by SnPCR alone showed almost perfect agreement with the results of the combined method (κ= 0.95) in the detection of BSFI [Table 5].
Table 5: Agreement between the results of semi-nested polymerase chain reaction method and combined method

Click here to view



  Discussion Top


Multiple defects in the immune system such as impaired neutrophil functions, disruption of skin and mucosal barriers, impaired cellular and humoral immunity, and impaired reticuloendothelial functions often affect the patients with cancer. As a result, cancer patients are commonly susceptible to infection caused by endogenous or exogenous fungi. The main underlying hematological conditions associated with fungemia in this study were ALL (77.4%) followed by AML (22.6%). These data are in agreement with previous reports.[14]

Timely detection of the fungal pathogens is a prerequisite for successful clinical outcome in patients with fungemia. In view of the changing epidemiology and the increasing variety of fungal genera and species observed in immunosuppressed patients, there is a growing demand for broad-spectrum diagnostic tests. Such a diagnostic test must be capable of detecting not only the entire range of pathogenic fungi but also more prudent delivering an accurate and timely result. The classical blood culture used for the diagnosis of fungal infection is time-consuming and of reduced sensitivity as compared with modern molecular methods like PCR and its variants. In this study, blood culture could detect only 6 (42.8%) cases as compared to 13 (92.8%) cases by SnPCR, which clearly showed the advantage of using SnPCR as a detection tool for the detection of BSFI. A total of 5 out of 6 blood culture-positive isolates by the conventional blood culture showed a 100% agreement with the sequencing result of SnPCR [Table 4]. The disagreement was seen only for one sample that grew as P. marneffei on blood culture, but SnPCR fails to detect its DNA in blood broth. The plausible explanations of this failure to detect DNA could be because of multiple reasons. The first reason could be due to the presence of an extremely low number of pathogens even after overnight incubation of blood in the broth. Since the SnPCR has a sensitivity limit of as low as 5 microorganisms/ml in original blood samples, therefore, the chance of missing a true pathogen after overnight incubation of blood in the broth is almost negligible. The second and more convincing reason is that P. marneffei might have grown in the blood culture bottle as a laboratory contaminant. False-positive blood culture resulting due to unwanted growth of culture contaminants has been recognized as an irksome issue for decades in medical laboratories.

In this study, we have successfully described the use of SnPCR to identify the most frequently encountered fungal pathogen from the overnight inoculated blood broth. In a previously conducted study, the authors have established the use of SnPCR for the diagnosis of candidemia with high sensitivity and specificity.[15] However, the authors in their study used serum directly as a sample which has few drawbacks. The SnPCR, when performed from direct biological samples such as serum and blood, has poor sensitivity due to the low count of microorganism and the presence of inhibitors such as hemoglobin, lactoferrin, and lipids.[16],[17] An overnight incubated blood in a broth allows the fungus to multiply and neutralize the inhibitors of blood and thus increases the detection rate. Furthermore, this study recommends the use of universal fungal primers ITS1 and ITS2 to amplify a conserved portion of the 18S rDNA region, the adjacent ITS1 region, and a small portion of the 5.8S rDNA region, thus yielding products with variable sizes among the major species that cause fungemia. Several studies have shown that the ITS1 or ITS2 regions are the most promising targets for the differentiation of Candida spp. and for refined discrimination between Aspergillus spp.[18],[19]

This study shows a predominance of Candida spp. as the causative agent of BSFI in children with hematological malignancies. As evident by the SnPCR result, Candida albicans (38.5%) was the most prevalent etiologic agent in this study as other earlier reports.[20] Few recent studies have noticed a trend that has changed the face of the epidemiology of infection, reporting steadily increase in a number of cases caused by non-albicans candida species (e.g., C. glabrata, C. krusei, C. tropicalis, and C. parapsilosis), particularly in patients with ALL.[21] No such dominance of non-albicans candida spp. over Candida albicans is seen in this study.

The pathogens causing mold BSFI in the earlier studies were mainly Aspergillus spp. and members of Zygomyces.[22],[23] In this study, we are reporting two Fusarium oxysporum and one A. fumigatu s as molds causing BSFI. F. oxysporum is currently gaining popularity as an emerging pathogen causing bloodstream infection.[24] The protocol discussed in this study can be completed within 8 hr and is simpler than any previously reported PCR protocols for molecular detection and identification of wide range of BSFI. However, like any other diagnostic test, this test is also not free from limitations. The biggest limitation of molecular test is that it cannot be used as a substitute for susceptibility testing. It is worth mentioning here that for the execution of antimicrobial susceptibility testing, the isolate obtained by culture is a prerequisite.


  Conclusion Top


The implementation of SnPCR-based fungal detection protocol will strengthen the diagnostic ability of clinical laboratory in terms of early and accurate detection of BSFI in leukemic children with febrile neutropenia.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Baytan B, Güneş AM, Çelebi S, Günay Ü. Invasive fungal diseases in children with hematologic disorders. Turk J Haematol 2009;26:190-6.  Back to cited text no. 1
    
2.
Teoh F, Pavelka N. How chemotherapy increases the risk of systemic candidiasis in cancer patients: Current paradigm and future directions. Pathogens 2016;5:6.  Back to cited text no. 2
    
3.
Rosen GP, Nielsen K, Glenn S, Abelson J, Deville J, Moore TB. Invasive fungal infections in pediatric oncology patients: 11-year experience at a single institution. J Pediatr Hematol Oncol 2005;27:135-40.  Back to cited text no. 3
    
4.
Pfaller MA, Jones RN, Messer SA, Edmond MB, Wenzel RP. National surveillance of nosocomial blood stream infection due to species of Candida other than Candida albicans: Frequency of occurrence and antifungal susceptibility in the SCOPE Program. SCOPE Participant Group. Surveillance and Control of Pathogens of Epidemiologic. Diagn Microbiol Infect Dis 1998;30:121-9.  Back to cited text no. 4
    
5.
Kumar D, Bhattacharyya S, Gupta P, Banerjee G, Kumar M, Singh M. Antifungal susceptibility of bloodstream Candida isolates in pediatric patients. Int J Curr Microbiol Appl Sci 2015;4:716-20.  Back to cited text no. 5
    
6.
Gamaletsou MN, Walsh TJ, Sipsas NV. Invasive fungal infections in patients with hematological malignancies: Emergence of resistant pathogens and new antifungal therapies. Turk J Haematol 2018;35:1-11.  Back to cited text no. 6
    
7.
Skiada A, Pavleas I, Drogari-Apiranthitou M. Rare fungal infectious agents: A lurking enemy. F1000Res 2017;6:1917.  Back to cited text no. 7
    
8.
Kumar D, Kumar Purbey M. Fungal infections in intensive care unit: Challenges in diagnosis. Natl J Lab Med 2017;6(2) MR01-MR04. [doi. org/10.7860/NJLM/2017/26949:2226.6MR01-MR04].  Back to cited text no. 8
    
9.
White PL, Perry MD, Barnes RA. An update on the molecular diagnosis of invasive fungal disease. FEMS Microbiol Lett 2009;296:1-0.  Back to cited text no. 9
    
10.
Hummel M, Spiess B, Roder J, von Komorowski G, Dürken M, Kentouche K, et al. Detection of Aspergillus DNA by a nested PCR assay is able to improve the diagnosis of invasive aspergillosis in paediatric patients. J Med Microbiol 2009;58:1291-7.  Back to cited text no. 10
    
11.
Kourkoumpetis TK, Fuchs BB, Coleman JJ, Desalermos A, Mylonakis E. Polymerase chain reaction-based assays for the diagnosis of invasive fungal infections. Clin Infect Dis 2012;54:1322-31.  Back to cited text no. 11
    
12.
Larone DH. Media. In: Larone DH, editor. Medically Important Fungi: A Guide to Identification. 4th ed. Washington, D.C: American Society for Microbiology; 2002. p. 327-8.  Back to cited text no. 12
    
13.
White TJ, Bruns TD, Lee S, Taylor JW. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR Protocols: A Guide to Methods and Applications. New York: Academic Press; 1990. p. 315-22.  Back to cited text no. 13
    
14.
Gülhan B, Kanık-Yüksek S, Özkaya-Parlakay A, Yaralı N, Tezer H, Özbek NY. Invasive fungal infection in children with hematologic malignancy. Turk J Pediatr 2019;61:159-65.  Back to cited text no. 14
    
15.
Ahmad S, Khan Z, Mustafa AS, Khan ZU. Seminested PCR for diagnosis of candidemia: Comparison with culture, antigen detection, and biochemical methods for species identification. J Clin Microbiol 2002;40:2483-9.  Back to cited text no. 15
    
16.
Selvarangan R, Bui U, Limaye AP, Cookson BT. Rapid identification of commonly encountered Candida species directly from blood culture bottles. J Clin Microbiol 2003;41:5660-4.  Back to cited text no. 16
    
17.
Schrader C, Schielke A, Ellerbroek L, Johne R. PCR inhibitors - occurrence, properties and removal. J Appl Microbiol 2012;113:1014-26.  Back to cited text no. 17
    
18.
Hinrikson HP, Hurst SF, Lott TJ, Warnock DW, Morrison CJ. Assessment of ribosomal large-subunit D1–D2, internal transcribed spacer 1, and internal transcribed spacer 2 regions as targets for molecular identification of medically important Aspergillus species. J Clin Microbiol 2005;43:2092-103.  Back to cited text no. 18
    
19.
Rakeman JL, Bui U, Lafe K, Chen YC, Honeycutt RJ, Cookson BT. Multilocus DNA sequence comparisons rapidly identify pathogenic molds. J Clin Microbiol 2005;43:3324-33.  Back to cited text no. 19
    
20.
Wingard JR. Importance of Candida species other than C. albicans as pathogens in oncology patients. Clin Infect Dis 1995;20:115-25.  Back to cited text no. 20
    
21.
Pfaller MA, Diekema DJ. Epidemiology of invasive candidiasis: A persistent public health problem. Clin Microbiol Rev 2007;20(1):133-63.  Back to cited text no. 21
    
22.
Richardson M, Lass-Flörl C. Changing epidemiology of systemic fungal infections. Clin Microbiol Infect 2008;14 Suppl 4:5-24.  Back to cited text no. 22
    
23.
Malani AN, Kauffman CA. Changing epidemiology of rare mould infections: Implications for therapy. Drugs 2007;67:1803-12.  Back to cited text no. 23
    
24.
Muhammed M, Anagnostou T, Desalermos A, Kourkoumpetis TK, Carneiro HA, Glavis-Bloom J, et al. Fusarium infection: Report of 26 cases and review of 97 cases from the literature. Medicine (Baltimore) 2013;92:305-16.  Back to cited text no. 24
    



 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Tables

 Article Access Statistics
    Viewed172    
    Printed4    
    Emailed0    
    PDF Downloaded40    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]