• Users Online: 426
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2015  |  Volume : 6  |  Issue : 3  |  Page : 106-110

Sensitive allele specific oligonucleotide-polymerase chain reaction in detection of preexisting mutations in imatinib-resistant chronic myelogenous leukemia patients: Aretrospective analysis


1 Department of Medical Oncology, Gujarat Cancer and Research Institute, Ahmedabad, Gujarat, India
2 Department of Molecular Biology, Gujarat Cancer and Research Institute, Ahmedabad, Gujarat, India

Date of Web Publication18-Sep-2015

Correspondence Address:
Mukul Arvind Gharote
D-403, Vasant Vihar, Phase 2, Airport Road, Shahibaug, Ahmedabad - 380 014, Gujarat
India
Login to access the Email id

Source of Support: Nil., Conflict of Interest: There are no conflicts of interest.


DOI: 10.4103/1658-5127.165648

Rights and Permissions
  Abstract 

Introduction: Pre-existing BCR-ABL kinase domain mutation leads to Imatinib resistance. Methods: Retrospective analysis of 50 patients of Imatinib resistance was done in GCRI, from January 2014 till May 2014. Allelle Specific Oligonucleotide–Polymerase Chain Reaction (ASO-PCR) was performed on Genomic DNA, of peripheral blood mononuclear cells (PBMCs). Results: 47 (94%) were in Chronic phase, 2 (4%) in accelerated phase, 1 (2%) in blastic crisis. Median duration of Imatinib was 48 months. 43/50 had one or more than 1 mutation, T315I mutation in 5 (10%) patients, M351T in 32% (16/50) and F311L in 8. Conclusion: We report low cytogenetic response (25%) and durability of response to 600 mg of Imatinib, even in M351T mutation.

Keywords: BCR-ABL kinase domain mutation, imatinib resistance, M351T mutation, pre-existing mutations


How to cite this article:
Gharote MA, Panchal H, Patel A, Parikh S, Rawal R, Shah K, Anand AS. Sensitive allele specific oligonucleotide-polymerase chain reaction in detection of preexisting mutations in imatinib-resistant chronic myelogenous leukemia patients: Aretrospective analysis. J Appl Hematol 2015;6:106-10

How to cite this URL:
Gharote MA, Panchal H, Patel A, Parikh S, Rawal R, Shah K, Anand AS. Sensitive allele specific oligonucleotide-polymerase chain reaction in detection of preexisting mutations in imatinib-resistant chronic myelogenous leukemia patients: Aretrospective analysis. J Appl Hematol [serial online] 2015 [cited 2021 Dec 2];6:106-10. Available from: https://www.jahjournal.org/text.asp?2015/6/3/106/165648


  Introduction Top


Chronic myeloid leukemia (CML) has long been used as a paradigm for understanding the molecular pathogenesis of malignancy. The success of imatinib, thefirst tyrosine-kinase inhibitor (TKI) to be introduced into clinical practice, is due to the ability of the inhibitor to occupy the ATP-binding pocket of the ABL-kinase domain (KD), which prevents a change in conformation of the protein to the active form of the molecule, with the subsequent death of target cells.[1]

KD mutations represent the most important disease-related factor in CML resistance. In multiple clinical studies, it is a consistent fraction (approximately 50% overall) of patients who, in the setting of clinical resistance, demonstrate BCR-ABL KD mutations.[2] It is clear from this consistent finding that resistance based in KD mutation may be a strong phenotype, and selection and dominance of such resistant subclones in patients with CML is logical. Highly resistant clones may preexist and emerge rapidly.[3] Patients with CML can acquire more than one BCR-ABL1 mutation during sequential TKI therapy, which may result in increased oncogenicity compared with each individual mutation.[4] Until now, more than 50 mutants have been described.[1]

With the aim to analyze retrospectively, with more sensitive detection method allele-specific oligonucleotide-polymerase chain reaction (ASO-PCR), the clinical nature of the patients with imatinib failure, having these mutations, and their response to imatinib, we did this analysis of 50 CML patients, who failed on imatinib. Majority of this patient failed well within the natural history of this disease despite being compliant, hinting for presence of preexisting mutations (PEMs).


  Methods Top


We performed this retrospective analysis of 50 CML patients with imatinib-resistant clones documented by mutational analysis. Hospital records of these patients were analyzed for clinical correlates such as median age, gender, phase of CML, prognostic score that is, EUTOS and SOKAL score, median time duration for resistance to treatment, response to imatinib (hematological, cytological and molecular), cumulative dose of imatinib given.

At 3 months, we looked for a hematological response. 1-year we looked for cytological remission and 18 months major molecular response (MMR). Mutation analysis for the mutations was done at thefirst sign of imatinib resistance, as defined by European leukemiaNet, 2009 criteria that is, postdiagnosis and posttherapy.

Genomic DNA was extracted from peripheral blood mononuclear cells using QIAmp DNA minikit (Qiagen), according to the manufacturer's recommendations. Quantity was estimated by Qubit fluorometer version 2.1. Mutated or wild-type sequences were specifically amplified in a separate PCR reaction performed on DNA in 25 µL reaction mixture using PCR master mix (Fermentas, thermo scientific, according to manufacturer instruction). Healthy volunteer was used as negative control.

Following PCR cycle was designed using allele-specific and reverse primers: For the Thr315Ile mutation, F315C (wild): 5 'GCC CCC GTT CTA TAT CAT CAC '3 or F315T (mutated): 5' CCC GTT CTA TAT CAT CAT '3 and Reverse: 5 'GGATGAAGT TTT TCT TCT CCAG '3, annealing at 64°C; 158-bp PCR product. For the Phe311Leu mutation, F311T (wild): 5' CAC CCG GGA GCC CCC GT '3 or F311C (Mutated): 5' CAC CCG GGA GCC CCC GC 3 and Reverse: 5'CCCCTACCTGGTGGATGAAGT'3 with annealing at 64.4°C; 174-bp PCR fragment. For the Met351Thr mutation, F351T (wild): 5'CCA CTC AGA TCT CGT CAG CCA T '3 or F351C (mutated): 5'CCACTC AGA TCT CGT CAG CCA C '3 and Reverse: 5'GCC CTG AGA CCT CCTAGG CT '3, annealing at 71.3°C; 112-bp PCR fragment.


  Results Top


Of approximately, 500 patients, who visited GCRI within January 2014 till May 2014, and complied to the study criteria, total 50 imatinib-resistant cases of CML were evaluated, males were outnumbering the females, 33 were males and 17 were females. Average age of the study group was 40.75 years. Of the 50 selected 47 (94%) were in chronic phase (CP), whereas 2 (4%) were in accelerated phase, 1 (2%) was in blastic crisis. 29 out of 50 were having low EUTOS score, whereas SOKAL score was low in 20, intermediate in 21 while only 9 were having high SOKAL at presentation [Table 1].
Table 1: Clinical characteristics of patients with mutations

Click here to view


Statistical analysis

Statistical analysis was done using graph pad prism 6 software. Our work was reviewed by the independent scientific review committee.

We treated every patient with imatinib 400 mg/day and dose was escalated to 600 mg at the time of clinical evidence of imatinib resistance, 28% (14/50) of the patients did not achieve complete hematological response at the end of 3 months of standard dose of imatinib (i.e., 400 mg/day). 86% (43/50) of the study group patients failed to achieve complete cytogenetic response (CCyR) at the end of 1-year of imatinib standard dose. Only 8% (4/50) of the patients in this study group achieved MMR at the end of 18 months of standard dose imatinib.

Cumulative imatinib dose was <400 mg/day in 11 (22%) patients, >600 mg/day in 1 patient, whereas it was 400–600 mg in 38 (76%) of the cases. 88% (n = 44) where having drug to drug compliance >85% [Table 2]. 86% (43/50) showed either one or more than 1 mutation. T315I mutation was detected in 5 (10%) patients. Out of which 1 had isolated T315I mutation whereas 4 had more than 1 mutation (T315I and F311L mutation [n = 2], T315I, M351T, and F311L [n = 2]). M351T mutation was seen in 32 (64%) patients. Out of which 32% (16/50) were having isolated M351T mutation, more than 1 mutation was seen in 16 (14 with F311L mutation, 2 had 3 mutation studied). F311L mutation was seen in 26 (52%) patients. Out of which 8 were having isolated F311L.
Table 2: Response to high-dose imatinib (600 mg)

Click here to view


The median duration of imatinib resistance and mutation detection was 36 months. The median duration of imatinib treatment in these patients before the detection of mutation was 48 months. Three patients stopped imatinib, because of pregnancy and 1 patient was intolerant to imatinib.

Response to 600 mg of imatinib in T315I mutation, none achieved CCyR (n = 5), 2 lost the hematological response also. In isolated M315T mutation (n = 16), 4 (25%) of the patient achieved CCyR, 1 achieved CCyR after 1-year. About the molecular response only 3 (18%) achieved it, 2 lost the MMR within 12 months. 1 lost MMR after 12 months of imatinib 600 mg. In isolated F311L mutation (n = 8), 2 achieved CCyR (25%), none achieved MMR.

In more than 1 mutation, as already stated, mutation involving T315I never achieved CCyR. Regarding the combination of M351T, and F311L, (n = 14), 14% (n = 2) achieved CCyR, none achieved MMR on 600 mg of imatinib.


  Discussion Top


In our study, 86% of the imatinib-resistant patient were having one or more than 1 mutation. This finding is comparable, as BCR-ABL KD mutations account for 50–90% of the imatinib resistance observed in patients of CML-CP.[5],[6]

M351T accounts for approximately 10% of mutations detected in the Western population. This mutation has a low-level imatinib insensitivity. It is thought to be associated with a loss of function and may be selected on drug exposure.[1] M351T mutation reduces BCR-ABL kinase activity and transforming capacity compared with wild-type BCR-ABL.[7] Several studies have reported that different KD mutations retain varying sensitivities to higher concentrations of imatinib, which suggests that higher doses could prevent the selection and expansion of some resistant mutant clones.[8] These mutations were found to retain biochemical sensitivity to imatinib at increased concentrations. However, in the study done by Branford et al., they did not find any significant difference in the selection of resistant mutations at an imatinib dose of 400 or 600 mg. It has been recently reported that clinical response may be regained with higher imatinib doses if M351T mutation is the sole abnormality.[9]

M351T, T315I, and F311L are reported as PEM by Iqbal et al.[10] In their study, the frequencies of the M351T, F311L, and T315I mutations were 87.5%, 50%, and 37.5%, respectively, either alone or in combination. Thus, M351T was the most common PEM, whereas T315I was the least common PEM detected. After a median follow-up of 30 months (range: 8–48), patients with BCR-ABL PEMs exhibited imatinib resistance (32/32, 100%). Upon re-investigation of BCR-ABL mutations in these patients using ASO-PCR and DNA sequencing, all patients had the same PEMs. Regarding the 68 patients without PEMs, imatinib resistance developed in 24 (24/68, 35.3%) patients. BCR-ABL mutations (alone or in combination) were found in 22 of these patients. T315I (12/22, 54.5%) and F311L (15/22, 68.2%) were the most common mutations in this group of patients, whereas M351T was detected in 9/21 (42.8%) patients.

In our study, we did not look for the preexistence of the mutation, but in our study the median duration of imatinib resistance and mutagenesis was 36 months, and median duration of treatment on imatinib 400 mg was 48 months. In addition, M351T mutation was the most common mutation in our study group, which had cumulative imatinib dose of < or = to 600 mg in 49/50 patients. Thus it seems that the mutation detected were preexisting and were selected by treatment offered.

In a study done by Rajappa et al., the most common reported mutation in 26/90 patients of imatinib resistance, T315I was reported as the most common mutation occurring in 9/26 (31%). In this study, 61.1% of the patient lost hematological response on dose escalation, which is quite high as compared to ours 14/50 (28%). However, in the analysis of 5 patients with T315I mutation found in our study, 2/5 (40%) lost the hematological response on dose escalation. Loss of cytogenetic response was seen in only 5%.[11] In Kidwai Bangalore, the most common mutation seen was T315I (4 patients) and M351T (4 patients).[12] Method of detection of the specific mutation significantly affects the results of the given study [Table 3].
Table 3: Various technologies available for identifying and quantifying BCR-ABL KD mutations[13]

Click here to view


Next generation sequencing has been recently employed in the early detection of KD mutation. This recent methodology may detect sensitive mutation 2–11 months earlier. But, they need to be coupled with extensive bioinformatics approach, so that low-level variants, must be segregated from background error.[14]

High incidence (32%) of M351T was detected in our study, as compared to data by another Indian study by Srivastava and Dutt, they reported an incidence of M351T of 10% in their study.[15] They studied imatinib resistance in CP only and not in accelerated phase and blastic crisis. Secondly, the method they used was Bidirectional sequencing analysis of the amplicon, acquired from RNA of the sample containing adequate BCR-ABL was compared with human genome sequencing. But sensitivity and reliability of mutation detection is critically dependent on the method employed, we used ASO-PCR while they used Bidirectional sequencing as the method of detection of mutation. Direct sequencing is not specifically designed to detect the mutation concerned.[13] ASO-PCR is proved to be a very economical, sensitive, and rapid technique for detection of KD mutations M351T, F317L, and F311C ABL mutation and is more sensitive than mutation detection by sequencing.[16] In a study done at AIIMS by Mir et al., 100 CML patients were screened for M351T mutation after 3 years of imatinib initiation. (40%) 40/100 were positive for M351T,[16] which is comparable to ours.

Response to 600 mg of imatinib was in T315I mutation, none achieved CCyR (n = 5), 2 lost the hematological response also. In isolated M315T mutation (n = 16), 4 (25%) of the patient achieved CCyR, 1 achieved CCyR after 1-year. About the molecular response only 3 (18%) achieved it, 2 lost the MMR within 12 months. 1 lost MMR after 12 months of imatinib 600 mg. In isolated F311L mutation (n = 8), 2 achieved CCyR (25%), none achieved MMR. As compared to the 74 patients data quoted by Breccia et al. regarding response to high-dose imatinib, complete cytogenetic response (CCyR) was achieved in 37% patients.[17]

As compared to other study regarding high-dose imatinib in mutation, our results were as follows in the study done by Iqbal et al.[10] Patients harboring the T315I mutation (alone or in combination with F311L/M351T) did not exhibit any response, and progressed to accelerated phase or blast-crises (12/32, 37.5%). Fifteen CML patients without PEMs harboring a T315I mutation (alone or in combination with F311L/M351T/Y253F) did not respond to imatinib dose escalation and progressed to an advanced phase, whereas 7 out of 9 (77.8%) patients harboring F311L/M351T mutations responded to dose escalation with complete hematological, cytogenetic, and molecular responses.

The reason for the low response in our study was low dose of imatinib offered for a relatively prolonged period of time 400 mg of imatinib was given for a median duration of 48 months. The other reason was possible emergence of clonal evolution which was not done in our study. Finally, compliance was < 85% in 12% of the cases, leading to low imatinib trough level might be the other reason for low response to high dose of imatinib in our patient. Final selection bias also can be the other reason, as we retrospectively selected the resistant patient, and retrospectively analyzed the response to both the standard dose as well as 600 mg dose of imatinib. Further analysis, in accordance to Marin et al.,[18] we found the response to 600 mg of imatinib was not durable. Out of the 32 patients with M351T mutation treated with 600 mg of imatinib all of them progressed within median of 21 months (range 8–30 months) of therapy leading to escalation of imatinib dose, second line TKI was not started due to financial constraints.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Apperley JF. Part I: Mechanisms of resistance to imatinib in chronic myeloid leukaemia. Lancet Oncol 2007;8:1018-29.  Back to cited text no. 1
    
2.
Ernst T, La Rosée P, Müller MC, Hochhaus A. BCR-ABL mutations in chronic myeloid leukemia. Hematol Oncol Clin North Am 2011;25:997-1008, v-vi.  Back to cited text no. 2
    
3.
Roche-Lestienne C, Soenen-Cornu V, Grardel-Duflos N, Laï JL, Philippe N, Facon T, et al. Several types of mutations of the Abl gene can be found in chronic myeloid leukemia patients resistant to STI571, and they can pre-exist to the onset of treatment. Blood 2002;100:1014-8.  Back to cited text no. 3
    
4.
Shah NP, Skaggs BJ, Branford S, Hughes TP, Nicoll JM, Paquette RL, et al. Sequential ABL kinase inhibitor therapy selects for compound drug-resistant BCR-ABL mutations with altered oncogenic potency. J Clin Invest 2007;117:2562-9.  Back to cited text no. 4
    
5.
Agarwal MB, Rathi SA. Will kinase domain mutations dictate the terms. Indian J Med Paediatr Oncol 2013;34:151-3.  Back to cited text no. 5
[PUBMED]  Medknow Journal  
6.
Ernst T, Erben P, Müller MC, Paschka P, Schenk T, Hoffmann J, et al. Dynamics of BCR-ABL mutated clones prior to hematologic or cytogenetic resistance to imatinib. Haematologica 2008;93:186-92.  Back to cited text no. 6
    
7.
Willis SG, Lange T, Demehri S, Otto S, Crossman L, Niederwieser D, et al. High-sensitivity detection of BCR-ABL kinase domain mutations in imatinib-naive patients: Correlation with clonal cytogenetic evolution but not response to therapy. Blood 2005;106:2128-37.  Back to cited text no. 7
    
8.
Corbin AS, La Rosée P, Stoffregen EP, Druker BJ, Deininger MW. Several Bcr-Abl kinase domain mutants associated with imatinib mesylate resistance remain sensitive to imatinib. Blood 2003;101:4611-4.  Back to cited text no. 8
    
9.
Branford S, Rudzki Z, Walsh S, Parkinson I, Grigg A, Szer J, et al. Detection of BCR-ABL mutations in patients with CML treated with imatinib is virtually always accompanied by clinical resistance, and mutations in the ATP phosphate-binding loop (P-loop) are associated with a poor prognosis. Blood 2003;102:276-83.  Back to cited text no. 9
    
10.
Iqbal Z, Aleem A, Iqbal M, Naqvi MI, Gill A, Taj AS, et al. Sensitive detection of pre-existing BCR-ABL kinase domain mutations in CD34 cells of newly diagnosed chronic-phase chronic myeloid leukemia patients is associated with imatinib resistance: Implications in the post-imatinib era. PLoS One 2013;8:e55717.  Back to cited text no. 10
    
11.
Rajappa S, Mallavarapu KM, Gundeti S, Paul TR, Jacob RT, Digumarti R. Kinase domain mutations and responses to dose escalation in chronic myeloid leukemia resistant to standard dose imatinib mesylate. Indian J Med Paediatr Oncol 2013;34:221-3.  Back to cited text no. 11
[PUBMED]  Medknow Journal  
12.
Bansal S, Prabhash K, Parikh P. Chronic myeloid leukemia data from India. Indian J Med Paediatr Oncol 2013;34:154-8.  Back to cited text no. 12
[PUBMED]  Medknow Journal  
13.
Hughes T, Deininger M, Hochhaus A, Branford S, Radich J, Kaeda J, et al. Monitoring CML patients responding to treatment with tyrosine kinase inhibitors: Review and recommendations for harmonizing current methodology for detecting BCR-ABL transcripts and kinase domain mutations and for expressing results. Blood 2006;108:28-37.  Back to cited text no. 13
    
14.
Machova Polakova K, Kulvait V, Benesova A, Linhartova J, Klamova H, Jaruskova M, et al. Next-generation deep sequencing improves detection of BCR-ABL1 kinase domain mutations emerging under tyrosine kinase inhibitor treatment of chronic myeloid leukemia patients in chronic phase. J Cancer Res Clin Oncol 2015;141:887-99.  Back to cited text no. 14
    
15.
Srivastava S, Dutt S. Imatinib mesylate resistance and mutations: An Indian experience. Indian J Med Paediatr Oncol 2013;34:213-20.  Back to cited text no. 15
[PUBMED]  Medknow Journal  
16.
Mir AR, Sazawal S, Saxena A, Saxena R. High-sensitivity detection of M351T, F317 L, and F311C BCR-ABL kinase domain mutation in chronic myeloid leukemia patients treated with novel tyrosine kinase inhibitors (TKIs) imatinib and dasatinib. J Clin Oncol 2009;27:15s. [(suppl; abstr 7061: 2009 ASCO Annual Meeting].  Back to cited text no. 16
    
17.
Breccia M, Stagno F, Vigneri P, Latagliata R, Cannella L, Del Fabro V, et al. Imatinib dose escalation in 74 failure or suboptimal response chronic myeloid leukaemia patients at 3-year follow-up. Am J Hematol 2010;85:375-7.  Back to cited text no. 17
    
18.
Marin D, Goldman JM, Olavarria E, Apperley JF. Transient benefit only from increasing the imatinib dose in CML patients who do not achieve complete cytogenetic remissions on conventional doses. Blood 2003;102:2702-3.  Back to cited text no. 18
    



 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Methods
Results
Discussion
Introduction
Methods
Results
Discussion
References
Article Tables

 Article Access Statistics
    Viewed2316    
    Printed60    
    Emailed0    
    PDF Downloaded254    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]